close

Se connecter

Se connecter avec OpenID

3) ADN polymérase

IntégréTéléchargement
CHMI 2227F
Biochimie I
Acides nucléiques:
-
réplication
CHMI 2227 - E.R. Gauthier, Ph.D.
1
Réplication de l’ADN

Le cycle cellulaire
définie une série
d’étapes menant à la
division cellulaire:
 Phase
S: réplication
de l’ADN
 Phase M: mitose
 Phases « gap » (G1 et
G2): préparation en
vue des phases S ou
M;
DNA
Nucleus
CHMI 2227 - E.R. Gauthier, Ph.D.
2
Réplication de l’ADN

Pendant la réplication de
l’ADN, une molécule d’ADN
est copiée en deux molécules
filles, et ce suivant les règles
établies par Watson et Crick:


Complémentarité des deux
brins (pairage des bases)
Antiparallélisme (i.e. les deux
brins courent en direction
5’3’ opposées);
5’AGCTAGCTGATATCGCGATCG3’
3’TGCATCGACTATAGCGCTAGC5’
5’AGCTAGCTGATATCGCGATCG3’
3’TGCATCGACTATAGCGCTAGC5’
5’AGCTAGCTGATATCGCGATCG3’
3’TGCATCGACTATAGCGCTAGC5’
CHMI 2227 - E.R. Gauthier, Ph.D.
3
Réplication de l’ADN

Questions à répondre:
 1)
Conservation des brins parentaux?
 2) Direction de la synthèse?
 3) Nature de la machinerie de synthèse?
 4) Activité d’édition?
CHMI 2227 - E.R. Gauthier, Ph.D.
4
Réplication de l’ADN
1) Conservation des brins parentaux

En théorie, la
réplication de l’ADN
peut se produire
selon différents
mécanismes, tout
dépendant de la
distribution des brins
parentaux parmi les
brins filles;
Conservatif
CHMI 2227 - E.R.
Gauthier, Ph.D.
Semi-conservatif
Non-conservatif
Dispersif 5
Réplication de l’ADN
1) L’expérience de Meselson et Stahl
CHMI 2227 - E.R. Gauthier, Ph.D.
PNAS 1958;44;671-682
6
Réplication de l’ADN
2) Directionalité de la réplication

Fourches de
réplication
Des études de microscopie
électronique ont révélé que la
réplication de l’ADN bactérien
survient de manière
bidirectionnelle:

Les deux brins sont dupliqués en
même temps;

Le site où a lieu la réplication est
appelé la fourche de
réplication;

Les brins parentaux sont
dénaturés à la fourche de
réplication;

La réplication débute à un point
spécifique du génome bactérien:
l’origine de réplication; CHMI 2227 - E.R. Gauthier, Ph.D.
7
Réplication de l’ADN
La fourche de réplication
3’
5’
5’
3’
3’
5’
Direction de la
fourche de réplication
Fourche de
réplication
3’
5’
CHMI 2227 - E.R. Gauthier, Ph.D.
8
Réplication de l’ADN
Les molécules d’ADN peuvent posséder
plusieurs fourches de réplication
CHMI 2227 - E.R. Gauthier, Ph.D.
9
Réplication de l’ADN
2) Directionalité de la réplication
Mais: comment se fait la
réplication par rapport à la
polarité des brins d’ADN?

EN d’autres mots, est-ce que
la réplication de l’ADN se fait::
3’
5’
3’

5’
De l’extrémité 5’ vers
l’extrémité 3’, OU
 De l’extrémité 3’ vers
l’extrémité 5’, OU
 Est-ce que ça fait une
différence???

3’
5’
3’
5’
CHMI 2227 - E.R. Gauthier, Ph.D.
10
Réplication de l’ADN
2) Directionalité de la réplication

Chez tous les
organismes vivants, la
réplication de l’ADN se
fait toujours dans la
direction 5’3’:
 Le
brin fille est allongé
par l’addition de
nouveaux nucléotides à
son bout 3’;
CHMI 2227 - E.R. Gauthier, Ph.D.
11
Réplication de l’ADN
2) Directionalité : Fragments d’Okazaki
CHMI 2227 - E.R. Gauthier, Ph.D.
12
Réplication de l’ADN
La fourche de réplication
CHMI 2227 - E.R. Gauthier, Ph.D.
13
Réplication de l’ADN
3) Nature de la machinerie de réplication

Matériel nécessaire pour la réplication de l’ADN:
 Gabarit
d’ADN (i.e. la molécule parentale d’ADN);
 Tous les 4 deoxynucléotides triphosphate (dNTPs:
dATP, dGTP, dCTP, dTTP);
 ADN polymérase (an enzyme)
 Une amorce d’ADN ou d’ARN pour initier la
réplication;
CHMI 2227 - E.R. Gauthier, Ph.D.
14
Réplication de l’ADN
3) ADN polymérase
CHMI 2227 - E.R. Gauthier, Ph.D.
15
Réplication de l’ADN
3) ADN polymérase

Le rôle de l’ADN polymérase est seulement de catalyser la formation du
lien phosphodiester. L’ADN pol n’a rien à voir avec le pairage des bases
(enfin…presque);

Processivité: nombre de liens phosphodiesters pouvant être synthétisés
par la polymérase avec qu’elle ne se détache de la molécule d’ADN.
CHMI 2227 - E.R. Gauthier, Ph.D.
16
Réplication de l’ADN
3) ADN polymérase
CHMI 2227 - E.R. Gauthier, Ph.D.
17
Réplication de l’ADN
3) ADN polymérase III de E. coli
CHMI 2227 - E.R. Gauthier, Ph.D.
18
Réplication de l’ADN
3) ADN polymérase III de E. coli
(Clamp loader)
(ADN polymérase)
CHMI 2227 - E.R. Gauthier, Ph.D.
19
Réplication de l’ADN
3) ADN polymérase III de E. coli
http://oregonstate.edu/instruction/bb492/figletters/FigG1.html
CHMI 2227 - E.R. Gauthier, Ph.D.
20
Réplication de l’ADN
3) ADN polymérase III de E. coli
Place
ADN
Ici!!
Sliding clamp
CHMI 2227 - E.R. Gauthier, Ph.D.
21
Réplication de l’ADN
3) Primase

L’ADN polymérase III ne peut
fonctionner que si une extrémité 3’OH
est disponible pour catalyser la
formation d’un lien phosphodiester;

En d’autres mots: avant que l’ADN pol
ne puisse agir, la synthèse de l’ADN
doit déjà être débutée…QUOI???

Ce bout 3’OH est fourni par une
enzyme appelée ADN primase.

L’ADN primase synthétise une courte
(10 nt) amorce d’ARN complémentaire
au gabarit d’ADN;

L’ADN pol I replacera plus tard cette
amorce d’ARN par de l’ADN;
CHMI 2227 - E.R. Gauthier, Ph.D.
22
Réplication de l’ADN
Initiation de la synthèse de l’ADN
CHMI 2227 - E.R. Gauthier, Ph.D.
23
Réplication de l’ADN
Synthèse du brin meneur
Déroule l’ADN
http://oregonstate.edu/instruction/bb492/figletters/FigH4.html
CHMI 2227 - E.R. Gauthier, Ph.D.
24
Réplication de l’ADN
Synthèse du brin retardataire

Se fait comme pour la synthèse
du brin meneur, exception faite
qu’une ADN primase synthétise
régulièrement une amorce
d’ARN;
CHMI 2227 - E.R. Gauthier, Ph.D.
25
Réplication de l’ADN
Brin retardataire
CHMI 2227 - E.R. Gauthier, Ph.D.
26
Réplication de l’ADN - ADN ligase
Lien
phosphodiester
manquant
CHMI 2227 - E.R. Gauthier, Ph.D.
27
Réplication de l’ADN
4) Édition
CHMI 2227 - E.R. Gauthier, Ph.D.
28
Réplication de l’ADN
4) Édition
CHMI 2227 - E.R. Gauthier, Ph.D.
29
Séquençage de l’ADN
CHMI 2227 - E.R. Gauthier, Ph.D.
30
PCR
CHMI 2227 - E.R. Gauthier, Ph.D.
31
PCR
CHMI 2227 - E.R. Gauthier, Ph.D.
32
CHMI 2227 - E.R. Gauthier, Ph.D.
33
Auteur
Document
Catégorie
Uncategorized
Affichages
21
Taille du fichier
7 517 KB
Étiquettes
1/--Pages
signaler