close

Se connecter

Se connecter avec OpenID

3) ADN polymérase

IntégréTéléchargement
CHMI 2227F
Biochimie I
Acides nucléiques:
-
réplication
CHMI 2227 - E.R. Gauthier, Ph.D.
1
Réplication de l’ADN
DNA
Nucleus
CHMI 2227 - E.R. Gauthier, Ph.D.
2
Réplication de l’ADN
5’AGCTAGCTGATATCGCGATCG3’
3’TGCATCGACTATAGCGCTAGC5’
5’AGCTAGCTGATATCGCGATCG3’
3’TGCATCGACTATAGCGCTAGC5’
5’AGCTAGCTGATATCGCGATCG3’
3’TGCATCGACTATAGCGCTAGC5’
CHMI 2227 - E.R. Gauthier, Ph.D.
3
Réplication de l’ADN
CHMI 2227 - E.R. Gauthier, Ph.D.
4
Réplication de l’ADN
1) Conservation des brins parentaux
Conservatif
CHMI 2227 - E.R.
Gauthier, Ph.D.
Semi-conservatif
Non-conservatif
Dispersif 5
Réplication de l’ADN
1) L’expérience de Meselson et Stahl
CHMI 2227 - E.R. Gauthier, Ph.D.
PNAS 1958;44;671-682
6
Réplication de l’ADN
2) Directionalité de la réplication
CHMI 2227 - E.R. Gauthier, Ph.D.
Fourches de
réplication
7
Réplication de l’ADN
La fourche de réplication
3’
5’
5’
3’
3’
5’
Direction de la
fourche de réplication
Fourche de
réplication
3’
5’
CHMI 2227 - E.R. Gauthier, Ph.D.
8
Réplication de l’ADN
Les molécules d’ADN peuvent posséder
plusieurs fourches de réplication
CHMI 2227 - E.R. Gauthier, Ph.D.
9
Réplication de l’ADN
2) Directionalité de la réplication
3’
5’
3’
5’
3’
5’
3’
5’
CHMI 2227 - E.R. Gauthier, Ph.D.
10
Réplication de l’ADN
2) Directionalité de la réplication
CHMI 2227 - E.R. Gauthier, Ph.D.
11
Réplication de l’ADN
2) Directionalité : Fragments d’Okazaki
CHMI 2227 - E.R. Gauthier, Ph.D.
12
Réplication de l’ADN
La fourche de réplication
CHMI 2227 - E.R. Gauthier, Ph.D.
13
Réplication de l’ADN
3) Nature de la machinerie de réplication
CHMI 2227 - E.R. Gauthier, Ph.D.
14
Réplication de l’ADN
3) ADN polymérase
CHMI 2227 - E.R. Gauthier, Ph.D.
15
Réplication de l’ADN
3) ADN polymérase
CHMI 2227 - E.R. Gauthier, Ph.D.
16
Réplication de l’ADN
3) ADN polymérase
CHMI 2227 - E.R. Gauthier, Ph.D.
17
Réplication de l’ADN
3) ADN polymérase III de E. coli
CHMI 2227 - E.R. Gauthier, Ph.D.
18
Réplication de l’ADN
3) ADN polymérase III de E. coli
(Clamp loader)
(ADN polymérase)
CHMI 2227 - E.R. Gauthier, Ph.D.
19
Réplication de l’ADN
3) ADN polymérase III de E. coli
http://oregonstate.edu/instruction/bb492/figletters/FigG1.html
CHMI 2227 - E.R. Gauthier, Ph.D.
20
Réplication de l’ADN
3) ADN polymérase III de E. coli
Place
ADN
Ici!!
Sliding clamp
CHMI 2227 - E.R. Gauthier, Ph.D.
21
Réplication de l’ADN
3) Primase
CHMI 2227 - E.R. Gauthier, Ph.D.
22
Réplication de l’ADN
Initiation de la synthèse de l’ADN
CHMI 2227 - E.R. Gauthier, Ph.D.
23
Réplication de l’ADN
Synthèse du brin meneur
Déroule l’ADN
http://oregonstate.edu/instruction/bb492/figletters/FigH4.html
CHMI 2227 - E.R. Gauthier, Ph.D.
24
Réplication de l’ADN
Synthèse du brin retardataire
CHMI 2227 - E.R. Gauthier, Ph.D.
25
Réplication de l’ADN
Brin retardataire
CHMI 2227 - E.R. Gauthier, Ph.D.
26
Réplication de l’ADN - ADN ligase
Lien
phosphodiester
manquant
CHMI 2227 - E.R. Gauthier, Ph.D.
27
Réplication de l’ADN
4) Édition
CHMI 2227 - E.R. Gauthier, Ph.D.
28
Réplication de l’ADN
4) Édition
CHMI 2227 - E.R. Gauthier, Ph.D.
29
Séquençage de l’ADN
CHMI 2227 - E.R. Gauthier, Ph.D.
30
PCR
CHMI 2227 - E.R. Gauthier, Ph.D.
31
PCR
CHMI 2227 - E.R. Gauthier, Ph.D.
32
CHMI 2227 - E.R. Gauthier, Ph.D.
33
Auteur
Document
Catégorie
Uncategorized
Affichages
24
Taille du fichier
6 704 KB
Étiquettes
1/--Pages
signaler