close

Se connecter

Se connecter avec OpenID

Ascona B-DNA Consortium

IntégréTéléchargement
Introduction to DNA
Lecture notes edited by John Reif from PPT lectures by:
Natalia Tretyakova, College of Pharmacy, U. of Minnesota
Richard Lavery, Institut de Biologie Physico-Chimique, Paris
Image from
http://zen-haven.dkhttp://zen-haven.dk
• DNA
• Double helix
• Stores genetic code as a linear
sequence of bases
• ≈ 20 Å in diameter
• Human genome ≈ 3.3 x 109 bp
• ≈ 25,000 genes
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
DNA Size Scale
Chemical bond
1Å
(10-10 m)
Amino acid
10 Å
(10-9 m)
Globular protein
100 Å
(10-8 m)
Virus
1000 Å (10-7 m)
Cell nucleus
1 mm
(10-6 m)
Bacterial cell
5 mm
(10-5 m)
Chromosome DNA
10 cm
(10-1 m)
Biological length scale
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
DNA BASES
The Building Blocks of DNA
OH ribose
H deoxyribose
Nucleoside
Nucleotide
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
 Nucleotides are linked by
phosphodiester bonds
 Strand has a direction
(5'3')
 DNA is negatively
charged on phosphate
backbone.
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
N7
C5
C4
C6
C8
N1
N9
C6
N3
C2
C4
C5
N1
C2
N3
Purine (Pur / R)
Pyrimidine (Pyr / Y)
Base families
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
DNA and RNA nucleobases
O
NH2
6
7
N
5
9N
4
1
N
N
N
N
NH
8
2
N
H
N
H
N
H
N
NH2
N
3
Purine
Adenine (A)
Guanine (G)
NH2
O
O
4
5
N
6
3
H3C
N
NH
NH
2
N1
H
Pyrimidine
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
N
H
O
Cytosine (C)
N
H
O
N
H
O
Thymine (T)
Uracil (U)
•(DNA only)
•(RNA only)
Purine Bases
The 9 atoms that make up the fused rings (5 carbon, 4 nitrogen) are numbered 1-9.
All ring atoms lie in the same plane.
Richard B. Hallick
Introductory Course in Biology or Biochemistry
Purine Nucleotides
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
Pyrimidine Bases
All pyrimidine ring atoms lie in the same plane.
Richard B. Hallick
Introductory Course in Biology or Biochemistry
Pyrimidine Nucleotides
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
•
•• Nomenclature of nucleobases, nucleosides,
and mononucleotides
•nucleobase
•(Deoxy)
•nucleoside
•Adenine (A)
•2’-Deoxyadenosine
(dA)
•2’- Deoxyguanosine
(dG)
•2’- Deoxythymidine
•(dT)
•2’- Deoxycytidine
•(dC)
•Uridine (U)
•Guanine (G)
•Thymine (T)
•Cytosine (C)
•Uracil (U)
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
•5’-mononucleotide
•Deoxyadenosine 5’-monophosphate
•(5’-dAMP)
•Deoxyguanosine 5’-monophosphate
•(5’-dGMP)
•Deoxythymidine 5’-monophosphate
•(5’-dTMP)
•Deoxycytidine 5’-monophosphate
•(5’-dCMP)
•Uridine 5’-monophosphate (5’-UMP)
Structural differences between DNA and RNA
•DNA
•RNA
O
O
H3C
NH
NH
N
O
H
Uracil (U)
N
O
H
Thymine (T)
HO
CH2
H
O
Base
H
O
Base
H
H
O
OH
H
H
2'-deoxyribose
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
CH2
H
H
O
HO
ribose
H
Deoxyribose Sugar
The hydroxyl groups on the 5'- and 3'carbons link to the phosphate groups
to form the DNA backbone.
Richard B. Hallick
Introductory Course in Biology or Biochemistry
Nucleosides
•A nucleotide is a nucleoside with one
or more phosphate groups covalently
attached to the 3'- and/or 5'-hydroxyl
group(s).
Richard B. Hallick
Introductory Course in Biology or Biochemistry
Preferred conformations of nucleobases and sugars in
DNA and RNA
NH2
NH2
N
N
HO
N
O
HO
O
O
N
O
OH
OH
Syn conformation
Anti conformation
•Sugar puckers:
•5.9 A
HO
2'
5'
•7.0 A
O
3'
BASE
1'
H (OH)
HO
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
2' endo (B-DNA)
HO HO
5'
3'
O
BASE
1'
H (OH)
3' endo (RNA)
Nucleosides Must Be Converted to
5’-Triphosphates to be Part of DNA and RNA
HO
HO
O
Base
Kin a se
ATP
OH
O
P O
O
HO
OH
Mo no p ho sp h a te
ATP
O
O
O
HO P O P O P O
HO
OH
OH
O
Base
OH
Trip h o sp h a te
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
Base
Kin a se
ATP
O
O
HO P O P O
HO
OH
Kin a se
O
Base
OH
Dip ho sp h a te
DNA BASE PAIRING
Thymine -Adenine
Cytosine -Guanine
Watson-Crick base pairs
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
A-T and G-C Base Pairing
Richard B. Hallick
Introductory Course in Biology or Biochemistry
Hydrogen bond donors and acceptors on each
edge of a base pair
Major groove
To
se
o
rib
y
ox
e
d
To
Minor groove
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
de
ox
yr i
bo
se
Purine always binds with a Pyrimidine
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
Base pair dimensions
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
RNA : A,U,G,C + ribose
DNA : A ,T,G,C + deoxyribose
DNA/RNA chemical structure
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
DNA BACKBONE STRUCTURE
Helix Axis View:
Backbone structure:
•
•
•
•
•
Alternating backbone of deoxyribose and phosphodiester groups
Chain has a direction (known as polarity), 5'- to 3'- from top to bottom
Oxygens (red atoms) of phosphates are polar and negatively charged
Bases extend away from chain, and stack atop each other
Bases are hydrophobic
Richard B. Hallick
Introductory Course in Biology or Biochemistry
OnScreen DNA Model app
B-DNA STRUCTURE
Video of DNA Helix Structure:
http://www.youtube.com/watch?v=ZGHkHMoyC5I
Contains material from:
Alberts, Bray, Hopkin, Johnson, Lewis, Raff, Roberts, Walter, Essential Cell Biology, Second Edition,
Garland Science Publishing, 2004
B-DNA Structure
20 Å
GC
AT
CG
CGCGTTGACAACTGCAGAATC
34 Å
TA
TA
GC
AT
Major
Groove
TA
3.4 Å
Strands are
antiparallel
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
Minor
Groove
CG
CG
GC
AT
GC
Features of the B-DNA Double Helix
•Two DNA strands form a helical spiral, winding around a helix axis in a right-handed spiral
•The two polynucleotide chains run in opposite directions
•The sugar-phosphate backbones of the two DNA strands wind around the helix axis like the railing of a sprial
staircase
•The bases of the individual nucleotides are on the inside of the helix, stacked on top of each other like the steps of a
spiral staircase.
Richard B. Hallick
Introductory Course in Biology or Biochemistry
B-DNA (axial view)
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
R.H. helix
B-DNA (lateral view)
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
•Base stacking: an axial view of B-DNA
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
PI Bonds – (Mechanism of PI Base Stacking)
Forces stabilizing DNA double helix
1.
Hydrogen bonding (2-3 kcal/mol per base pair)
2. Stacking (hydrophobic) interactions
(4-15 kcal/mol per base pair)
3. Electrostatic forces.
Comparison to other bonds
1. Covalent Bond Energies:
1. C-C 85 kcal/mol
2. C-O 87 kcal/mol
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
•B-DNA
•right handed helix
• helical axis passes through
•base pairs
•23.7 A
••Sugars are in the 2’ endo
conformation.
HO
O
3'
•7.0 A
BASE
1'
H (OH)
HO
• planes of bases are nearly
•perpendicular to the helix axis.
2'
5'
••Bases are the anti conformation.
NH2
• 3.4 A rise between base pairs
N
•Wide and deep
N
HO
O
O
OH
••Bases have a helical twist of
34.6º (10.4 bases per helix turn)
•Narrow and deep
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
• Helical pitch = 34 A
•DNA can deviate from the ideal Watson-Crick structure
• Helical twist ranges from 28 to 42°
• Propeller twisting 10 to 20°
•Base pair roll
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
DNA grooves
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
Major groove and Minor groove of DNA
•Hypothetical situation: the two grooves would have similar size if dR residues
•were attached at 180° to each other
•To deoxyribose-C1’
Base
•C1’ -To deoxyribose
Base
Major groove
Major groove
•N
•O
•N
•H•2•N
•NH
•N
•N
•C-1’
e
os
b
i
r
xy
o
de
o
T
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
•N
•N
•N
•C-1’
•N
•NH•2
Minor groove
•O
•NH•2
•C-1’
To
d
•N
•O
•HN
•O
eox
y
r ib
ose
Minor groove
•N
•C-1’
•Major and minor groove of the double
helix
Major groove
•O
•N
•H•2
•N
•NH
•N
•N
•NH•2
•C-1’
se
To
o
rib
y
ox
de
•N
•N
•O
•C-1’T
•N
•NH•2
•N
•N
•C-1’
•N
•O
•HN
•O
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
eox
Minor groove
•Wide and deep
•Narrow and deep
od
•N
•C-1’
yr i
bo
se
•B-type duplex is not possible for RNA
HO
CH2
O
Base
H
H
O
OH
H
ribose
•steric “clash”
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
H
A-DNA STRUCTURE
De-hydration
Hydration
5’
3’
3’
5’
Antiparallel
strands
B
A
A and B DNA allomorphs
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
A-DNA (longitudinal view)
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
R.H. helix
A-DNA (lateral view)
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
•A-form helix: dehydrated DNA; RNA-DNA hybrids
•
•Right handed helix
••Sugars are in the 3’ endo
conformation.
• planes of bases are tilted
•20 ° relative the helix axis.
••Bases are the anti conformation
• 2.3 A rise between base pairs
•25.5 A
••11 bases per helix turn
• Helical pitch = 25.3 A
•Top View
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
The sugar puckering in A-DNA is 3’-endo
•5.9 A
O
2'
5'
•7.0 A
O
3'
BASE
1'
H (OH)
O
2' endo (3' exo) B-DNA
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
O
O
5'
3'
BASE
1'
O
2'
H (OH)
3' endo (A-DNA)
A-DNA has a shallow minor
groove and a deep major groove
Major groove
O H2N
N
To
e N
os
b
i
yr
x
o
de
••
NH
Major groove
N
N
NH2
O
N To d
eo
xy
Minor groove
••
•Helix axis
rib
os
e
To
•B-DNA
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
O H2N
N
e
os
ir b
y
ox
e
d
N
NH
N
N
NH2
O
Minor groove
•A-DNA
N To d
eo
xy
rib
os
e
Z-DNA STRUCTURE
Z-DNA (longitudinal view)
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
L.H. helix
Z-DNA (lateral view)
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
Base pairs are rotated in Z-DNA
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
•Z-form double helix: polynucleotides of alternating purines
and pyrimidines (GCGCGCGC) at high salt
•
•Left handed helix
•• Backbone zig-zags because suga
puckers alternate between 2’ endo
pyrimidines and 3’ endo (purines)
• planes of the bases are
•tilted 9° relative the helix
•axis.
•• Bases alternate between anti
(pyrimidines) and syn conformation
(purines).
• 3.8 A rise between base pairs
••12 bases per helix turn
•18.4 A
••
••
Flat major groove
Narrow and deep minor groove
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
• Helical pitch = 45.6 A
Sugar and base conformations in Z-DNA alternate:
•5’-GCGCGCGCGCGCG
•3’-CGCGCGCGCGCGC
•C: sugar is 2’-endo, base is anti
•G: sugar is 3’-endo, base is syn
NH2
O
N
HO
2'
5'
O
3'
1'
H
HO
C
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
N
HN
O
N
H2N
HO HO
5'
N
3'
N
O
1'
G
H
Comparing A, B and Z-DNA
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
• Biological relevance of the minor types of DNA secondary
structure
•Although the majority of chromosomal DNA is in B-form,
•some regions assume A- or Z-like structure
• Runs of multiple Gs are A-like
•The upstream sequences of some genes contain
•5-methylcytosine = Z-like duplex
NH2
H3C
N
N
H
O
5-methylcytosine (5-Me-C)
• Structural variations play a role in DNA-protein interactions
• RNA-DNA hybrids and ds RNA have an A-type structure
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
Backbone Dihedrals
n0
Backbone dihedrals - I
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
+10
°
+60
°
Staggered
Eclipsed
Dihedral angle definition
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
gauche +
gauche -
trans
Favoured conformations
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
:
O3’ – P – O5’ – C5’
g-
:
P – O5’ – C5’ – C4’
t
g:
O5’ – C5’ – C4’ – C3’
g+
:
C5’ – C4’ – C3’ – O3’
g+
e:
C4’ – C3’ – O3’ – P
t
z:
C3’ – O3’ – P – O5’
g-
(Y) :
O4’ – C1’ – N1 – C2
(R) :
O4’ – C1’ – N9 – C4
Backbone dihedrals - II
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
g-
syn-anti glycosidic conformations
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
C5’
Base
ENDO
EXO
Sugar ring puckering
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
Sugar pucker
described as
pseudorotation
North : C3’-endo
East : O4’-endo
South : C3’-endo
"2 B or not 2 B ...."
W. Shakespeare 1601
tan P = (n4 - n1) - (n3 - n0)
n4
n0
2n2 (Sin 36° + Sin72°)
n1
n3
Amp = n2 / Cos P
n2
Pseudorotation Equations
Altona et al. J. Am. Chem. Soc. 94, 1972, 8205
Base
Preferred sugar puckers
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
Sugar pucker and P-P distance
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
UNUSUAL DNA STRUCTURES
Reversed Watson-Crick
Watson-Crick
Hoogsteen
Reversed Hoogsteen
Alternative base pairs
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
- note C(N3) protonation
Watson-Crick + Hoogsteen = Base triplet
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
Triple helix DNA
Guanine Hoogsteen pairing  Base tetraplex
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
Watson Crick vs Hoogsteen
Hydrogen Bonding.
(inset, G-C bonding also shown)
Robert E Johnson et. al
University of Texas Medical Branch
Quadruplex DNA
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
Inverted repeat can lead to loop formation
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
Holliday junction
DNA cruciform
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
PNA versus DNA
 Achiral, peptide-like backbone
 Backbone is uncharged  High thermal stability
 High-specificity hybridization with DNA
 Resistant to enzymatic degradation
 Can displace DNA strand of duplex
 Pyrimidine PNA strands can form 2:1 triplexes with ssDNA
 Biotechnological applications
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
Peptide Nucleic acid(PNA)
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
Parallel-stranded DNA
I-DNA: intercalated parallel-stranded duplexes
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
 and  nucleotide anomers
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
H  OH is not the only change in passing from DNA to RNA ....
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
Biophysical properties of DNA
Biophysical properties of DNA
•
•
•
Facile denaturation (melting) and re-association of the duplex
are important for DNA’s biological functions.
In the laboratory, melting can be induced by heating.
A260
•Single strands
•T°
TM
•duplex
70
•
•
80
90
100
T, C
Hybridization techniques are based on the affinity of complementary
DNA strands for each other.
• Duplex stability is affected by DNA length, % GC base pairs, ionic strength, the
presence of organic solvents, pH
Tretyakova
••College of•Natalia
Negative
charge – can be separated by gel electrophoresis
Pharmacy, U. of Minnesota
•Separation of DNA fragments by PAGE
• DNA strands are negatively charged .
• Migrate towards the (+) electrode (anode)
• Migration time ~ ln ( number of base pairs)
Principles of Nucleic Acid Structure, W. Saenger, 1984 Springer-Verlag
Nucleic Acid Structure, Ed. S. Neidle, 1999 Oxford University Press
DNA Structure and Function, R.R. Sinden, 1994 Academic Press
Biochemistry, D. Voet and J.G. Voet, 1998 DeBoeck
The Eighth Day of Creation, H.F. Judson, 1996 Cold Spring Harbour Press
Books on DNA
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
HISTORY of DNA
1865
Gregor Mendel publishes his work on plant breeding with the notion
of "genes" carrying transmissible characteristics
1869
"Nuclein" is isolated by Johann Friedrich Miescher à Tübingen
in the laboratory of Hoppe-Seyler
1892
Meischer writes to his uncle "large biological molecules composed
of small repeated chemical pieces could express a rich language in
the same way as the letters of our alphabet"
1920
Recognition of the chemical difference between DNA and RNA
Phoebus Levene proposes the "tetranucleotide hypothesis"
1938
William Astbury obtains the first diffraction patters of DNA fibres
History of DNA
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
1944
Oswald Avery (Rockefeller Institute) proves that DNA carries the
genetic message by transforming bacteria
History of DNA
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
1950
Erwin Chargaff discovers A/G = T/C
History of DNA
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
1953
Watson and Crick propose the double helix as the structure of DNA
based on the work of Erwin Chargaff, Jerry Donohue, Rosy Franklin
and John Kendrew
History of DNA
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
Maurice Wilkins – Kings College, London
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
•Watson-Crick model of DNA was based on X-ray
•diffraction picture of DNA fibres
•(Rosalind Franklin and Maurice Wilkins)
•
•Rosalind Franklin
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
Rosalind Franklin (in Paris)
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
X-ray fibre diffraction pattern of B-DNA
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
Linus Pauling’s DNA
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
DNA secondary structure – double helix
•James Watson and Francis Crick, 1953- proposed a model for DNA
structure
•Francis Crick
Jim Watson
•DNA is the molecule of heredity (O.Avery, 1944)
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
•X-ray diffraction (R.Franklin and M. Wilkins)
Watson and Crick
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
It has not escaped our notice
that the specific pairing we have
postulated suggests a possible
copying mechanism for the
genetic material.
It has not escaped our notice …
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
Double helix ?
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
Nucleic Acids
DNA
RNA
•(ribonucleic acids)
•(deoxyribonucleic acids)
Central Dogma of Biology
•replication
DNA
RNA
Proteins
•transcription •translation
•DNA
•Natalia Tretyakova
•College of Pharmacy, U. of Minnesota
Cellular Action
Dickerson Dodecamer (Oct. 1980)
Richard Lavery
Institut de Biologie Physico-Chimique, Paris
Auteur
Документ
Catégorie
Без категории
Affichages
4
Taille du fichier
9 122 Кб
Étiquettes
1/--Pages
signaler