close

Se connecter

Se connecter avec OpenID

Bio-Informatique

IntégréTéléchargement
BIO-INFORMATIQUE
Analyse de séquences nucléotidiques
Illustration: http://www.arradx-almac.com/diagnostics/bioinformatics-consultancy.aspx
Objectifs
•
•
•
•
•
•
Format Fasta
Logiciel d’édition ApE
BLAST
Prédiction de gènes
Design primers
Recherche de sites de restriction
Analyse critique des résultats
Mise en situation
Arabidopsis thaliana
Recherche de gènes candidats
impliqués dans la résistance à
la sécheresse
Création banque cDNA
Trouver des infos sur le vecteur pUC57
Enregistrer la séquence du vecteur vide en format .fasta
Système de sélection Blanc/Bleu:
Le format FASTA
(rappel)
FASTA = format de séquence (ARN, ADN, acides aminés)
utilisable par de nombreux outils bioinformatiques
Programme: Bloc Note
>Identifiant (commentaire)
Ce caractère indique le début d’une nouvelle séquence
AATTCCGGAATAAATGGCAA
(séquence)
Enregistrer « .fasta »
Pour faciliter l’alignement des caractères:
dans WORD, utiliser police Courier Taille 8 ou 10
Logiciel d’édition : ApE
http://biologylabs.utah.edu/jorgensen/wayned/ape/
Logiciel gratuit et convivial d’édition de séquence
Permet alignement, création de carte de restriction, obtenir un réverse complémentaire,
rechercher des ORF,…
Logiciel d’édition : ApE
http://biologylabs.utah.edu/jorgensen/wayned/ape/
Logiciel gratuit et convivial d’édition de séquence
Permet alignement, création de carte de restriction, obtenir un réverse complémentaire,
rechercher des ORF,…
Recherche d’éléments connus
(features)
Logiciel d’édition : ApE
http://biologylabs.utah.edu/jorgensen/wayned/ape/
Logiciel gratuit et convivial d’édition de séquence
Permet alignement, création de carte de restriction, obtenir un réverse complémentaire,
rechercher des ORF,…
Distinguer la séquence de l’insert de celle du vecteur:
VecScreen
http://www.ncbi.nlm.nih.gov/VecScreen/VecScreen.html
Distinguer la séquence de l’insert de celle du
vecteur: VecScreen
Logiciel d’édition : ApE
Tools: Align sequences
(…)
(…)
Traduire ADN en protéine, trouver la phase de
lecture codante
Via ExPASy et ORF Finder
Deux programmes simples :
-
OK pour génomes procaryotes
-
OK si départ de cDNA car pas d’introns
-
MAIS à partir d’ADNg d’organismes eucaryotes, besoin de programmes plus
sophistiqués
Traduire ADN en protéine, trouver la phase de
lecture codante
ExPASy
Outil de traduction
http://www.expasy.ch/tools/dna.html
Présente les 6 cadres de lecture possibles
Traduire ADN en protéine, trouver la phase de
lecture codante
ExPASy
Outil de traduction
http://www.expasy.ch/tools/dna.html
Présente les 6 cadres de lecture possibles
Sélection des ORF probables: taille > 300 bp entre un START et un STOP
Lien direct vers BLAST
Mise en évidence d’ORF
http://www.ncbi.nlm.nih.gov/projects/gorf/
Mise en évidence d’ORF
http://www.ncbi.nlm.nih.gov/projects/gorf/
Récupération de la séquence nucléotidique
de l’ORF de notre choix en .fasta
Identification de la fonction potentielle
http://blast.ncbi.nlm.nih.gov/Blast.cgi
« Basic Local Alignment Search Tool »
- Regions of local similarity between sequences.
Calculates the statistical significance of matches
Calcul d’un score de similarité et une E-value (probabilité d’obtenir cette
similitude par hasard)
Au plus la E-value est faible au plus il est probable que les deux séquences
comparées soient homologues
- Plusieurs types de BLAST:
Nucleotide or protein sequences VS nucleotide or protein or translated DNA
sequence databases
« Basic Local Alignment Search Tool »
Blast de la séquence entière (pas que l’ORF)
« Basic Local Alignment Search Tool »
Code couleur:
en fonction des E-values croissantes
Primer design
Critères de départ:
-
Longueur: entre 18 et 25 bp
-
Séquence: % en GC compris entre 50 et 60 %
séquence se terminant par un C ou G
-
Température de melting:
T°m : 4(GC)+2(AT)
identiques pour les deux primers
REM : si bouts flottants, ne pas tenir compte de cette partie non
hybridée pour les premiers cycles
-
Structures secondaires, dimères de primers, self dimers,…
Toujours simuler la PCR in silico avant la commande des primers
http://engels.genetics.wisc.edu/amplify/
Primer design
http://frodo.wi.mit.edu/primer3/
Primer design
Primer design
Analyseur d’oligonucléotides:
http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/#Structure%202
ADNc <> ADNg recherche d’introns-exons
http://www.ncbi.nlm.nih.gov/spidey/
MAIS, il faut disposer de la séquence
cDNA et gDNA
ADNc <> ADNg recherche d’introns-exons
http://www.ncbi.nlm.nih.gov/spidey/
MAIS, il faut disposer de la séquence
cDNA et gDNA
On évite alors de choisir des primers à proximité (min 2 bases de distance) de l’intron mis en évidence
Trouver des sites de restriction
http://rna.lundberg.gu.se/cutter2/
Trouver des sites de restriction
Logiciel ApE
Trouver des sites de restriction
Logiciel ApE
Trouver des sites de restriction
Logiciel ApE
Trouver des sites de restriction
Site de New England Biolabs : une mine d’informations sur les enzymes de restriction!!!
https://www.neb.com/products/restriction-endonucleases
Tout ce qu’il faut savoir sur les digestions par enzymes de restriction:
Guide technique PDF à télécharger gratuitement
Des outils pratiques:
NEBcutter 2.0
http://tools.neb.com/NEBcutter2/index.php
Trouver des sites de restriction
http://tools.neb.com/NEBcutter2/index.php
Trouver des sites de restriction
Site de New England Biolabs : une mine d’informations sur les enzymes de restriction!!!
https://www.neb.com/products/restriction-endonucleases
Tout ce qu’il faut savoir sur les digestions par enzymes de restriction:
Guide technique PDF à télécharger gratuitement
Des outils pratiques:
NEBcutter 2.0
http://tools.neb.com/NEBcutter2/index.php
et meme, … super pratiques:
Enzyme finder https://www.neb.com/tools-and-resources/interactive-tools/enzyme-finder
Trouver des sites de restriction
https://www.neb.com/tools-and-resources/interactive-tools/enzyme-finder
Analyse taux de GC
http://www.genomatix.de/cgi-bin/tools/tools.pl
Functional analyse
http://www.ebi.ac.uk/Tools/pfa/iprscan/
Functional analyse
http://pfam.sanger.ac.uk/
Auteur
Документ
Catégorie
Без категории
Affichages
4
Taille du fichier
4 248 Кб
Étiquettes
1/--Pages
signaler