close

Se connecter

Se connecter avec OpenID

Chapter 17.

IntégréTéléchargement
From Gene
to Protein
How Genes
Work
AP Biology
What do genes code for?

How does DNA code for cells & bodies?

how are cells and bodies made from the
instructions in DNA
DNA
AP Biology
proteins
cells
bodies
The “Central Dogma”

Flow of genetic information in a cell

How do we move information from DNA to proteins?
DNA
replication
AP Biology
RNA
protein
DNA gets
all the glory,
but proteins do
all the work!
trait
Metabolism taught us about genes

Inheritance of metabolic diseases
suggested that genes coded for enzymes
 each disease (phenotype) is caused by
non-functional gene product





lack of an enzyme
Tay sachs
PKU (phenylketonuria)
albinism
metabolic pathway
A

AP Biology enzyme 1
Am I just the
sum of my proteins?
disease
disease
disease
disease
B
C
D
E

enzyme 2

enzyme 3

enzyme 4
1941 | 1958
Beadle & Tatum
one gene : one enzyme hypothesis
George Beadle
Edward Tatum
AP Biology
"for their discovery that genes act by
regulating definite chemical events"
Beadle & Tatum
X rays or ultraviolet light
Wild-type
Neurospora
create mutations
asexual
spores
Minimal
medium
spores
Growth on
complete
medium
positive control
Select one of
the spores
Test on minimal
medium to confirm
presence of mutation
negative control
Grow on
complete medium
Minimal media supplemented only with…
experimentals
Choline
Pyridoxine
Riboflavin
Minimal
Nucleic
Arginine
control
amino acid p-Amino
Niacin
Inositol acid Folic
supplements
acid
Thiamine
benzoic acid
AP Biology
a
a
From gene to protein
nucleus
cytoplasm
transcription
DNA
a
a
translation
mRNA
a
a
a
a
a
a
a
a
a
a
a
protein
a
a
a
a
a
a
a
ribosome
trait
AP Biology
Transcription
from
DNA nucleic acid language
to
RNA nucleic acid language
AP Biology
2007-2008
RNA


ribose sugar
N-bases
uracil instead of thymine
U : A
C : G



single stranded
lots of RNAs

DNA
AP Biology
mRNA, tRNA, rRNA, siRNA…
transcription
RNA
Transcription

Making mRNA


transcribed DNA strand = template strand
untranscribed DNA strand = coding strand


synthesis of complementary RNA strand


same sequence as RNA
transcription bubble
enzyme

RNA polymerase
5
C
DNA
G
3
A
G
T
A T C
T A
53
G
A G C
A
T
C G T
A
C
T
3
G C A U C G U
C
G T A G C A
T
T
A
C
A G
C T
G
A
T
A
T
3
5
unwinding
rewinding
mRNA
AP Biology
build
RNA
coding strand
5
RNA polymerase
template strand
RNA polymerases

3 RNA polymerase enzymes

RNA polymerase 1



RNA polymerase 2


AP Biology
transcribes genes into mRNA
RNA polymerase 3


only transcribes rRNA genes
makes ribosomes
only transcribes tRNA genes
each has a specific promoter sequence
it recognizes
Which gene is read?

Promoter region
binding site before beginning of gene
 TATA box binding site
 binding site for RNA polymerase
& transcription
factors


Enhancer region

binding site far
upstream of gene
turns transcription
on HIGH
AP Biology

Transcription Factors

Initiation complex

transcription factors bind to promoter region




AP Biology
suite of proteins which bind to DNA
hormones?
turn on or off transcription
trigger the binding of RNA polymerase to DNA
Matching bases of DNA & RNA

Match RNA bases to DNA
bases on one of the DNA
strands
A
G
C
A
G
G
U
U
C
A
AG
U
C
G
A
U
A
C
5'
RNA
A C C polymerase G
A
U
3'
T G G T A C A G C T A G T C A T CG T A C CG T
AP Biology
U
C
Eukaryotic genes have junk!

Eukaryotic genes are not continuous

exons = the real gene


expressed / coding DNA
introns
come out!
introns = the junk

inbetween sequence
intron = noncoding (inbetween) sequence
eukaryotic DNA
exon = coding (expressed) sequence
AP Biology
mRNA splicing

Post-transcriptional processing




eukaryotic mRNA needs work after transcription
primary transcript = pre-mRNA
mRNA splicing
 edit out introns
make mature mRNA transcript
intron = noncoding (inbetween) sequence
~10,000 base
eukaryotic DNA
exon = coding (expressed) sequence
pre-mRNA
primary mRNA
transcript
AP Biology
mature mRNA
transcript
~1,000 base
spliced mRNA
Discovery of exons/introns
Richard
Roberts
CSHL
Philip
Sharp
MIT
beta-thalassemia
AP Biology
1977 | 1993
adenovirus
common cold
Splicing must be accurate

No room for mistakes!

a single base added or lost throws off the
reading frame
AUGCGGCTATGGGUCCGAUAAGGGCCAU
AUGCGGUCCGAUAAGGGCCAU
AUG|CGG|UCC|GAU|AAG|GGC|CAU
Met|Arg|Ser|Asp|Lys|Gly|His
AP Biology
AUGCGGCTATGGGUCCGAUAAGGGCCAU
AUGCGGGUCCGAUAAGGGCCAU
AUG|CGG|GUC|CGA|UAA|GGG|CCA|U
Met|Arg|Val|Arg|STOP|
Whoa! I think
we just broke
a biological “rule”!
RNA splicing enzymes

snRNPs



small nuclear RNA
exon
proteins
Spliceosome


exon
3'
spliceosome
5'
3'
cut & paste gene
No,
not smurfs!
“snurps”
AP Biology
intron
5'
several snRNPs
recognize splice
site sequence

snRNPs
snRNA
mature mRNA
lariat
5'
exon
5'
3'
exon
3'
excised
intron
Alternative splicing

Alternative mRNAs produced from same gene


when is an intron not an intron…
different segments treated as exons
Starting to get
hard to
define a gene!
AP Biology
More post-transcriptional processing

Need to protect mRNA on its trip from
nucleus to cytoplasm

enzymes in cytoplasm attack mRNA



protect the ends of the molecule
add 5 GTP cap
add poly-A tail
 longer tail, mRNA lasts longer: produces more protein
3'
mRNA
5'
AP Biology
P
G P
P
A
a
a
From gene to protein
nucleus
cytoplasm
transcription
DNA
a
a
translation
mRNA
a
a
a
a
a
a
a
a
a
a
a
protein
a
a
a
a
a
a
a
ribosome
trait
AP Biology
Translation
from
nucleic acid language
to
amino acid language
AP Biology
2007-2008
How does mRNA code for proteins?
DNA
TACGCACATTTACGTACGCGG
4 ATCG
mRNA
4 AUCG
protein
AUGCGUGUAAAUGCAUGCGCC
?
Met Arg Val Asn Ala Cys Ala
20
AP Biology
How can you code for 20 amino acids
with only 4 nucleotide bases (A,U,G,C)?
mRNA codes for proteins in triplets
DNA
TACGCACATTTACGTACGCGG
codon
mRNA
AUGCGUGUAAAUGCAUGCGCC
?
protein
AP Biology
Met Arg Val Asn Ala Cys Ala
Cracking the code

1960 | 1968
Nirenberg & Khorana
Crick

determined 3-letter (triplet) codon system
WHYDIDTHEREDBATEATTHEFATRAT

Nirenberg (47) & Khorana (17)
determined mRNA–amino acid match
 added fabricated mRNA to test tube of
ribosomes, tRNA & amino acids



AP Biology
created artificial UUUUU… mRNA
found that UUU coded for phenylalanine
Marshall Nirenberg
1960 | 1968
Har Khorana
AP Biology
The code

Code for ALL life!


strongest support for
a common origin for
all life
Code is redundant


several codons for
each amino acid
3rd base “wobble”
Why is the
wobble good?

Start codon



AP Biology
AUG
methionine
Stop codons

UGA, UAA, UAG
How are the codons matched to
amino acids?
DNA
mRNA
3
5
5
3
TACGCACATTTACGTACGCGG
AUGCGUGUAAAUGCAUGCGCC
3
UAC
tRNA
amino
acid
AP Biology
Met
codon
5
GCA
Arg
CAU
Val
anti-codon
a
a
From gene to protein
nucleus
cytoplasm
transcription
DNA
a
a
translation
mRNA
a
a
a
a
a
a
a
a
a
a
a
protein
a
a
a
a
a
a
a
ribosome
aa
trait
AP Biology
Transfer RNA structure

“Clover leaf” structure
anticodon on “clover leaf” end
 amino acid attached on 3 end

AP Biology
Loading tRNA

Aminoacyl tRNA synthetase


enzyme which bonds amino acid to tRNA
bond requires energy



ATP  AMP
bond is unstable
so it can release amino acid at ribosome easily
Trp C=O
OH
OH
Trp C=O
O
Trp
H2O
O
activating
enzyme
tRNATrp
anticodon
AP Biology
tryptophan attached
to tRNATrp
AC C
UGG
mRNA
tRNATrp binds to UGG
condon of mRNA
Ribosomes

Facilitate coupling of
tRNA anticodon to
mRNA codon


organelle or enzyme?
Structure
ribosomal RNA (rRNA) & proteins
 2 subunits



AP Biology
large
small
E P A
Ribosomes

A site (aminoacyl-tRNA site)


P site (peptidyl-tRNA site)


holds tRNA carrying next amino acid to
be added to chain
holds tRNA carrying growing
polypeptide chain
Met
E site (exit site)

AP Biology
empty tRNA
leaves ribosome
from exit site
U A C
A U G
5'
E
P
A
3'
Building a polypeptide

Initiation


Elongation


brings together mRNA, ribosome
subunits, initiator tRNA
adding amino acids based on
codon sequence
Termination

3 2 1
end codon
Leu
Val
Met
Met
Met
Met Leu
Ala
Leu
Leu
release
factor
Ser
Trp
tRNA
U AC
5'
C UGAA U
mRNA A U G
3'
E P A
AP Biology
5'
UAC GAC
A U G C U GAA U
5'
3'
U A C GA C
A U G C U G AAU
5'
3'
U AC G A C
AA U
AU G C U G
3'
A CC
U GG U A A
3'
Destinations:
Protein targeting



Signal peptide

address label




start of a secretory pathway
AP Biology

secretion
nucleus
mitochondria
chloroplasts
cell membrane
cytoplasm
etc…
RNA polymerase
DNA
Can you tell
the story?
amino
acids
exon
intron
tRNA
pre-mRNA
5' GTP cap
mature mRNA
aminoacyl tRNA
synthetase
poly-A tail
large ribosomal subunit
polypeptide
5'
small ribosomal subunit
AP Biology
tRNA
E P A
ribosome
3'
The Transcriptional unit (gene?)
enhancer
1000+b
20-30b
3'
RNA
TATA
polymerase
translation
start
TAC
translation
stop
exons
transcriptional unit (gene)
5'
DNA
ACT
DNA
UTR
promoter
UTR
introns
transcription
start
transcription
stop
5'
pre-mRNA
AP Biology
5'
GTP mature mRNA
3'
3'
AAAAAAAA
Bacterial chromosome
Protein
Synthesis in
Prokaryotes
Transcription
mRNA
Psssst…
no nucleus!
Cell
membrane
Cell wall
AP Biology
2007-2008
Prokaryote vs. Eukaryote genes

Prokaryotes

Eukaryotes


DNA in cytoplasm
circular
chromosome
naked DNA

no introns





DNA in nucleus
linear
chromosomes
DNA wound on
histone proteins
introns vs. exons
introns
come out!
intron = noncoding (inbetween) sequence
eukaryotic
DNA
exon = coding (expressed) sequence
AP Biology
Translation in Prokaryotes

Transcription & translation are simultaneous
in bacteria
DNA is in
cytoplasm
 no mRNA
editing
 ribosomes
read mRNA
as it is being
transcribed

AP Biology
Translation: prokaryotes vs. eukaryotes

Differences between prokaryotes &
eukaryotes

time & physical separation between
processes


AP Biology
takes eukaryote ~1 hour
from DNA to protein
no RNA processing
Any Questions??
What color would a smurf turn
if he held his breath?
AP Biology
2007-2008
Substitute Slides
for Student Print version
AP Biology
2007-2008
Can you tell
the story?
AP Biology
The Transcriptional unit
enhancer
exons
1000+b
20-30b
3'
RNA
TATA
polymerase
TAC
transcriptional unit
5'
DNA
ACT
introns
5'
3'
5'
AP Biology
3'
Auteur
Документ
Catégorie
Без категории
Affichages
4
Taille du fichier
5 810 Кб
Étiquettes
1/--Pages
signaler