close

Se connecter

Se connecter avec OpenID

Bordeaux RNA Club Symposium 8th

IntégréTéléchargement
Bordeaux
Bordeaux RNA Club
Symposium
2016
JUNE
23
Organizing committee
F. Darfeuille
C. Di Primo
D. Dupuy
S. Fribourg
C. Grosset
A. Innis
C. Mackereth
L. Minvielle-Sébastia
M. Teichmann
J.-J. Toulmé
Invited speakers
Jennifer Doudna
University of California, Berkeley
Pascale Cossart
Institut Pasteur
Jamie Cate
University of California, Berkeley
Luisa Cochella
IMP Vienna
Sam Griffiths-Jones
University of Manchester
IECB Auditorium
2, rue Robert Escarpit
33600 Pessac, France
JUNE
2016
RNA
CLUB
8
th
24
Pôle Juridique et Judiciaire
35, Place Pey Berland
33000 Bordeaux, France
Registration is free but mandatory
www.rnaclub.u-bordeaux.fr
facebook.com/RNAbordeaux
@RNAbordeaux
UGUUGACAUGGGGAAACGAGCAUAGAGACGAUACGAUCACGACUACUGAGAGCUAA
GGGUUUUUAGAGCCCAUAGUGUGACAUGAGACUACAUUGUCGGAGAGCGGAUUUA
CGCGCGCGGGAAUUAUUUUUCGCAUUUGGCAAUUUGGCGCCCCCGAGAAGUUUCGA
UGUGUGCACUGGUGUGUUGACAUGGGGAAACGAGCAUAGAGACGAUACGAUCACG
ACUACUGAGAGCUAGACUACAUUGUCGGAGAGCGGAUUUACGCGCGCGGGAAUUAU
UUUUCGCAUUUGGCAAUUUGGCGCCCCCGAGAAGUUUCGAUGUGUGCACUGGUGU
GUUGACAUGGGGAAACGAGCAUAGAGACGAUACGAUCACGACUACUGAGAGCUAGA
CUACAUUGUCGGAGAGCGGAUUUACGCGCGCGGGAAUUAUUUUUCGCAUUUGGCAA
UUUGGCGCCCCCGAGAAGUUUCGAUGUGUGCACUGGUGUGUUGACAUGGGGAAAC
GAGCAUAGAGACGAUACGAUCACGACUACUGAGAGCUAGACUACAUUGUCGGAGAG
CGGAUUUACGCGCGCGGGAAUUAUUUUUCGCAUUUGGCAAUUUGGCGCCCCCGAGA
AGUUUCGAUGUGUGCACUGGUGUGUUGACAUGGGGAAACGAGCAUAGAGACGAUA
CGAUCACGACUACUGAGAGCUAGACUACAUUGUCGGAGAGCGGAUUUACGCGCGCG
GGAAUUAUUUUUCGCAUUUGGCAAUUUGGCGCCCCCGAGAAGUUUCGAUGUGUGC
ACUGGUGUGUUGACAUGGGGAAACGAGCAUAGAGACGAUACGAUCACGACUACUGA
GAGCUAGACUACAUUGUCGGAGAGCGGAUUUACGCGCGCGGGAAUUAUUUUUCGCA
UUUGGCAAUUUGGCGCCCCCGAGAAGUUUCGAUGUGUGCACUGGUGUGUUGACAU
GGGGAAACGAGCAUAGAGACGAUACGAUCACGACUACUGAGAGCUAGACUACAUUG
UCGGAGAGCGGAUUUACGCGCGCGGGAAUUAUUUUUCGCAUUUGGCAAUUUGGCG
CCCCCGAGAAGUUUCGAUGUGUGCACUGGUGUGUUGACAUGGGGAAACGAGCAUA
GAGACGAUACGAUCACGACUACUGAGAGCUAGACUACAUUGUCGGAGAGCGGAUUU
ACGCGCGCGGGAAUUAUUUUUCGCAUUUGGCAAUUUGGCGCCCCCGAGAAGUUUCG
AUGUGUGCACUGGUGUGUUGACAUGGGGAAACGAGCAUAGAGACGAUACGAUCAC
GACUACUGAGAGCUAGACUACAUUGUCGGAGAGCGGAUUUACGCGCGCGGGAAUUA
UUUUUCGCAUUUGGCAAUUUGGCGCCCCCGAGAAGUUUCGAUGUGUGCACUGGUG
UGUUGACAUGGGGAAACGAGCAUAGAGACGAUACGAUCACGAAUUUGAAGAAUUUA
UACUGAGGAGCAUAGAGACGAUACGAUCACGACUACUGAGAGCUAGACUACAUUGU
Organized
CGGAGAGCGGAUUUACGCGCGCGGGAAUUAUUUUUCGCAUUUGGCAAUUUGGCGCC
jointly with
CCCGAGAAGUUUCGAUGUGUGCACUGGUGUGUUGACAUGGGGAAACGAGCAUAGA
Registration and abstract submission
for oral communications & posters
should be sent to
rnaclub@u-bordeaux.fr
by May 15, 2016
June 24-25,2016
Bordeaux, France
www.aptamers-in-bordeaux.com
Auteur
Document
Catégorie
Uncategorized
Affichages
0
Taille du fichier
8 543 KB
Étiquettes
1/--Pages
signaler